/ 
Into Unscientific Chapter 53
Download
https://novelcool.info/novel/Into-Unscientific.html
https://novelcool.info/chapter/Into-Unscientific-Chapter-52/9231965/
https://novelcool.info/chapter/Into-Unscientific-Chapter-54/9231967/

Into Unscientific Chapter 53

  Chapter 53 The fourth generation, breakthrough!

  The cyclization of the target pheromone went very smoothly, but Xu Yun did not relax in the slightest.

  This biomedical laboratory is used for 14 days, although on the bright side, as long as the research team solves the synthesis of the fourth-generation imidacloprid within this time, it can be considered a success.

  But as mentioned earlier, Xu Yun's ultimate goal is far from being as simple as a four-generation team.

  Because this experiment required a lot of equipment, the whole project borrowed the name of Tian Liangwei's auxiliary project from the beginning of the project.

  Once the time limit is over, it will be difficult for even Tian Liangwei to provide Xu Yun with such good experimental conditions.

   Therefore, this can be said to be Xu Yun's best opportunity at present. Once it is missed, it will delay the research and development of the fifth-generation imidacloprid at least, and may affect the opening of knowledge points and time-space dungeons at worst.

  So after completing the cyclization of the target pheromone, Xu Yun and others did not slack off at all, and continued the stirring reaction for 12 hours.

   And in the early morning of the next day, the reaction was quenched with saturated NH4Cl aqueous solution under ice cooling.

  At this point, the rest is to synthesize the pheromone-binding protein with imidacloprid, which is also the main direction of several biology graduate students.

  In layman's terms, this link is an infinite number of chances. The pheromone-binding protein after cyclization is like an iron ring. For better understanding, let's assume that it is divided into twelve grids according to the clock scale.

  What Xu Yun and others have to do is to take a small steel ball and throw it from top to bottom. Since they have done ring processing on the direction from 9 to 12 o'clock, the falling point of the steel ball must be between 9-12 o'clock.

But this scale is far from fine enough. Only when the steel ball falls steadily to the number of 46 points can the synthesis of Xu Yun and others be considered successful—please note that this is just a relatively easy-to-understand statement from a macro perspective. In fact, the circle The scale number of the disk is infinitely larger than 12, for example, .

   "22440484 pairs!"

  In the laboratory, Zhou Peiyao looked at the numbers sequenced by the IlluminaHiSeq high-throughput next-generation sequencing platform, and said to Xu Yun calmly:

   "Senior, we have studied the binding ability of two OBPs to target pheromones through small molecule fluorescent competitive binding experiments. The total amount of base data obtained is about 6.6G, and the number of reads after filtering out the original data is 22440484.

  The target pheromone has a genome comparison consistency of about 84.62% with the American cockroach sample, and 83.68% with the German cockroach, and the theoretical value of the junction reads is 648! "

  22440484 to 648, a probability of 1 in 35,000, this is by no means a simple matter.

  Hearing this number, Xu Yun nodded lightly, then turned to look at Qiu Sheng:

   "Old Qiu, it's up to us."

  Qiu Sheng patted him on the shoulder and said with a smile:

   "It's nothing to say, Ganbai, the big deal is to sacrifice all of my buddy's hair here."

   As he spoke, his expression became solemn, and he picked up a note similar to a supermarket receipt and glanced at it:

   "19.10 and 19.36kDa, the position of the protein electrophoresis band is consistent with the predicted molecular weight, Xiao Ren, let's go to the fluorescence competition binding test directly.

   Try to measure the binding ability of 3,11-dimethyl n-hexacosan-2-one and the target pheromone within three hours, so that we will be much more relaxed. "

  By the side, Ren Yongcun adjusted his glasses and skillfully combined the two reagents that had been prepared a long time ago.

  Xu Yun stood in a well-ventilated ultrclean bench, and added 1 μg of the quantified target pheromone, 4 μg of Anchored Oligo, 10 μl of 2×ESReactionMix, 1 μl of gDNARemover, and finally added RNase-freeWater until the volume of the mixture was 20 μl.

   Then he mixed 20 μl of the mixture by flicking the test tube and handed it to Zhou Peiyao:

   "Xiao Zhou, set 42°C, incubate in the PCR instrument for 15 minutes, then heat at 85° for 5 seconds.

   Then quantify the synthesized cDNA template, and store it in an environment of minus 20 degrees after passing the 1.2% agarose gel electrophoresis test. "

  Zhou Peiyao took the test tube and nodded heavily:

   "Don't worry, senior!"

  If yesterday's cyclization experiment was a Cthulhu dog food article, then today's synthesis experiment is undoubtedly a healing story.

   While asleep, it was awakened.

  The peers around him urged it:

   "Hey, it's time to get up, you haven't moved since the last cycle."

   Oh, it came to mind, it is a linear depolymerase, and its sigma factor has not yet been encountered.

  Although Christmas was just a few days ago, it was just an ordinary night for it.

  He just walked and walked with his companion, and after an unknown period of time, a gentle call came from its ear.

"How are you?"

  It turned its head and saw a beautiful figure, slim and graceful, smiling like a flower.

  It didn't know how to answer for a while, so it could only say dryly:

   "How are you?"

  She is so beautiful that it dare not ask for anything, maybe she just came to ask where is the nearest promoter, where the polymerase is much stronger than its synthetic ability.

   "That. I'm an Oligo primer. I accidentally lost my way. Can I trouble you to show me the way?"

  It looked her in the eyes and said without thinking:

"OK."

   It connected her binding domains gentlemanly, and she acquiesced shyly, and they just walked around in the nuclear matrix, counting the beautiful bands on the chromosomes with her.

   That's it, I don't know how many cycles have passed.

  One day, she suddenly shook its beta pincers in surprise:

   "Look there!"

   It looked in the direction of her finger, and it was a sequence:

  AUGAUACUCUAGGUGGAGUAUUGAUGA

that is not.

   Love's password?

  She flew all the way over, leaning gently on the -35 sequence, her face fascinated.

  Looking at this scene, suddenly, it mustered up the courage:

   "That. Can you be my girlfriend?"

  Her expression froze suddenly, with a trace of bitterness on her face:

   "I'm just a primer, may die tomorrow, our union is cursed"

   "Definitely not! We will be happy forever!"

  It hugged her and stretched apart the two tightly bound complementary chains.

  She didn't make much resistance, so they started their love journey.

  Everything is going well. It looks at the chain of messengers extending behind it, and looks back at the cutest girl in its eyes. The urge to protect her for the rest of its life surges in its heart.

   To have such a lovely girl to accompany for a lifetime, I am really lucky for three lives!

   Just like that, another period of time passed.

  However, one day, an accident happened.

  The temperature of this world suddenly began to drop, and a large amount of matter began to wither, freeze or even die.

  It used all its strength to tightly surround her, but with a jolt, the structural domain that combined it with her suddenly loosened!

  It screamed heart-piercingly:

   "Hold on to me, don't let go! I'll find a way!"

  Her helpless response came from the trembling, with despair and crying:

   "It's useless, I can't do it!"

   After a burst of circulation, she got farther and farther away from it.

   "Complete our messenger chain, I will always love you!"

  Her small figure slowly faded out of its sight, disappearing into the icy nuclear layer.

  It looked up to the sky and shouted in despair, angrily scolding the injustice of fate.

   But the road to go has to go on, but now it is alone.

  It struggled to open the glued double strands, and placed the nucleotides one by one, and each base represented its deep yearning for her.

   But gradually, it also felt tired.

  The surrounding electrons are constantly attacking its core protein, and its subunits are gradually loosened. The most shocking thing is that behind it, a short ubiquitin chain has been extended from some time.

  It understands that its life is coming to an end.

  When it was dying, her smile flashed in its mind.

  It turns out that I have always missed her so much, it turns out that I have always loved her deeply.

   Then it dragged its remnant body, walking slowly like this, and finally came to a deep pit.

   At this moment, there are countless polymerases identical to it lying in the deep pit. It is not difficult to see from the double strands that they have all met their own version of her.

  It moved to a corner with some difficulty, looking at the sky out of focus:

   "Does it mean that the combination of primers is doomed to have no results?"

  In the haze, her three-dimensional structure appeared in front of him, she seemed to be looking at it with a smile, and opened her arms to it

   At a thousandth of an instant when its consciousness was about to dissipate, two figures, one big and one small, suddenly appeared in his peripheral vision:

  It was a similar figure to him, and he had no partner by his side, but on one of its chains, it was leading a beautifully carved little girl.

   "That is. That is"

  His breathing suddenly became rapid.

  In fact, it wasn't just him. Almost instantly, due to tio's guiding effect, every 'it' in the deep pit sensed the figure of the person coming.

   "Honey, did you see that?!"

  It exhausted the last bit of strength in its body, and just laughed like this:

   "It turns out that our love is not cursed."

at the same time.

  Looking at the extremely small red dot on the hot spot of RPKM value, Xu Yun was inexplicably melancholy:

   "The fourth generation has finally broken through."

   It's been a long time since I've watched some Chinese manga, and I have a question to ask, why are all Chinese manga now in 3D?

   In addition, drive the train today, just change the day to keep fit

  (end of this chapter)

Chapter end

Report
<<Prev
Next>>
Catalogue
Chapter 746
Chapter 745
Chapter 744
Chapter 743
Chapter 742
Chapter 741
Chapter 740
Chapter 739
Chapter 738
Chapter 737
Chapter 736
Chapter 735
Chapter 734
Chapter 733
Chapter 731
Chapter 730
Chapter 729
Chapter 728
Chapter 727
Chapter 726
Chapter 725
Chapter 724
Chapter 723
Chapter 722
Chapter 721
Chapter 720
Chapter 719
Chapter 718
Chapter 717
Chapter 716
Chapter 715
Chapter 714
Chapter 713
Chapter 712
Chapter 711
Chapter 710
Chapter 709
Chapter 708
Chapter 707
Chapter 706
Chapter 704
Chapter 703
Chapter 702
Chapter 701
Chapter 700
Chapter 699
Chapter 698
Chapter 697
Chapter 696
Chapter 695
Chapter 694
Chapter 693
Chapter 692
Chapter 691
Chapter 690
Chapter 689
Chapter 688
Chapter 687
Chapter 686
Chapter 685
Chapter 684
Chapter 683
Chapter 682
Chapter 681
Chapter 680
Chapter 679
Chapter 678
Chapter 677
Chapter 676
Chapter 675
Chapter 674
Chapter 673
Chapter 672
Chapter 671
Chapter 670
Chapter 669
Chapter 668
Chapter 667
Chapter 666
Chapter 665
Chapter 664
Chapter 663
Chapter 662
Chapter 661
Chapter 660
Chapter 659
Chapter 658
Chapter 657
Chapter 656
Chapter 655
Chapter 654
Chapter 653
Chapter 652
Chapter 651
Chapter 650
Chapter 649
Chapter 648
Chapter 647
Chapter 646
Chapter 645
Chapter 643
Chapter 642
Chapter 641
Chapter 640
Chapter 639
Chapter 638
Chapter 637
Chapter 636
Chapter 635
Chapter 634
Chapter 633
Chapter 632
Chapter 631
Chapter 630
Chapter 629
Chapter 628
Chapter 627
Chapter 625
Chapter 624
Chapter 623
Chapter 622
Chapter 621
Chapter 620
Chapter 619
Chapter 618
Chapter 617
Chapter 616
Chapter 615
Chapter 614
Chapter 613
Chapter 612
Chapter 611
Chapter 610
Chapter 609
Chapter 608
Chapter 607
Chapter 606
Chapter 605
Chapter 604
Chapter 603
Chapter 602
Chapter 601
Chapter 600
Chapter 599
Chapter 598
Chapter 597
Chapter 596
Chapter 595
Chapter 594
Chapter 593
Chapter 592
Chapter 591
Chapter 590
Chapter 589
Chapter 588
Chapter 587
Chapter 586
Chapter 585
Chapter 584
Chapter 583
Chapter 582
Chapter 581
Chapter 580
Chapter 579
Chapter 578
Chapter 577
Chapter 576
Chapter 575
Chapter 574
Chapter 573
Chapter 572
Chapter 571
Chapter 570
Chapter 569
Chapter 568
Chapter 567
Chapter 566
Chapter 565
Chapter 564
Chapter 563
Chapter 562
Chapter 561
Chapter 560
Chapter 559
Chapter 558
Chapter 557
Chapter 556
Chapter 555
Chapter 554
Chapter 553
Chapter 552
Chapter 551
Chapter 550
Chapter 549
Chapter 548
Chapter 547
Chapter 546
Chapter 545
Chapter 544
Chapter 543
Chapter 542
Chapter 541
Chapter 540
Chapter 539
Chapter 538
Chapter 537
Chapter 536
Chapter 535
Chapter 534
Chapter 533
Chapter 532
Chapter 531
Chapter 530
Chapter 529
Chapter 528
Chapter 527
Chapter 526
Chapter 525
Chapter 524
Chapter 523
Chapter 522
Chapter 521
Chapter 520
Chapter 519
Chapter 518
Chapter 517
Chapter 516
Chapter 515
Chapter 514
Chapter 513
Chapter 512
Chapter 511
Chapter 510
Chapter 509
Chapter 508
Chapter 507
Chapter 506
Chapter 505
Chapter 504
Chapter 503
Chapter 502
Chapter 501
Chapter 500
Chapter 499
Chapter 498
Chapter 497
Chapter 496
Chapter 495
Chapter 494
Chapter 493
Chapter 492
Chapter 491
Chapter 490
Chapter 489
Chapter 488
Chapter 487
Chapter 486
Chapter 483
Chapter 482
Chapter 481
Chapter 480
Chapter 479
Chapter 478
Chapter 477
Chapter 476
Chapter 475
Chapter 474
Chapter 473
Chapter 472
Chapter 471
Chapter 470
Chapter 469
Chapter 468
Chapter 467
Chapter 466
Chapter 465
Chapter 464
Chapter 463
Chapter 462
Chapter 461
Chapter 460
Chapter 459
Chapter 458
Chapter 457
Chapter 456
Chapter 455
Chapter 454
Chapter 453
Chapter 452
Chapter 451
Chapter 449
Chapter 448
Chapter 447
Chapter 446
Chapter 445
Chapter 444
Chapter 443
Chapter 442
Chapter 441
Chapter 440
Chapter 439
Chapter 438
Chapter 437
Chapter 436
Chapter 435
Chapter 434
Chapter 433
Chapter 432
Chapter 431
Chapter 429
Chapter 428
Chapter 427
Chapter 426
Chapter 425
Chapter 424
Chapter 423
Chapter 422
Chapter 421
Chapter 420
Chapter 419
Chapter 418
Chapter 417
Chapter 416
Chapter 415
Chapter 414
Chapter 413
Chapter 412
Chapter 411
Chapter 410
Chapter 409
Chapter 408
Chapter 407
Chapter 406
Chapter 405
Chapter 404
Chapter 403
Chapter 402
Chapter 401
Chapter 400
Chapter 399
Chapter 395
Chapter 394
Chapter 393
Chapter 392
Chapter 391
Chapter 390
Chapter 389
Chapter 388
Chapter 387
Chapter 386
Chapter 385
Chapter 384
Chapter 383
Chapter 382
Chapter 381
Chapter 380
Chapter 379
Chapter 378
Chapter 377
Chapter 376
Chapter 375
Chapter 374
Chapter 373
Chapter 372
Chapter 371
Chapter 370
Chapter 369
Chapter 368
Chapter 367
Chapter 366
Chapter 365
Chapter 364
Chapter 363
Chapter 362
Chapter 361
Chapter 360
Chapter 359
Chapter 358
Chapter 357
Chapter 356
Chapter 355
Chapter 354
Chapter 353
Chapter 352
Chapter 351
Chapter 350
Chapter 349
Chapter 348
Chapter 347
Chapter 346
Chapter 345
Chapter 344
Chapter 343
Chapter 342
Chapter 341
Chapter 340
Chapter 339
Chapter 338
Chapter 337
Chapter 336
Chapter 335
Chapter 334
Chapter 333
Chapter 332
Chapter 331
Chapter 330
Chapter 329
Chapter 328
Chapter 327
Chapter 326
Chapter 324
Chapter 322
Chapter 321
Chapter 320
Chapter 319
Chapter 318
Chapter 317
Chapter 316
Chapter 315
Chapter 314
Chapter 313
Chapter 312
Chapter 311
Chapter 310
Chapter 309
Chapter 308
Chapter 307
Chapter 306
Chapter 305
Chapter 304
Chapter 303
Chapter 302
Chapter 301
Chapter 300
Chapter 299
Chapter 298
Chapter 297
Chapter 296
Chapter 295
Chapter 294
Chapter 293
Chapter 292
Chapter 291
Chapter 290
Chapter 289
Chapter 288
Chapter 287
Chapter 286
Chapter 285
Chapter 284
Chapter 283
Chapter 282
Chapter 281
Chapter 280
Chapter 279
Chapter 278
Chapter 277
Chapter 276
Chapter 275
Chapter 274
Chapter 273
Chapter 272
Chapter 271
Chapter 270
Chapter 269
Chapter 268
Chapter 267
Chapter 266
Chapter 265
Chapter 264
Chapter 263
Chapter 262
Chapter 261
Chapter 260
Chapter 259
Chapter 258
Chapter 257
Chapter 256
Chapter 255
Chapter 254
Chapter 253
Chapter 252
Chapter 251
Chapter 250
Chapter 249
Chapter 248
Chapter 247
Chapter 246
Chapter 245
Chapter 244
Chapter 243
Chapter 242
Chapter 241
Chapter 240
Chapter 239
Chapter 238
Chapter 237
Chapter 236
Chapter 235
Chapter 234
Chapter 233
Chapter 232
Chapter 231
Chapter 230
Chapter 229
Chapter 228
Chapter 227
Chapter 226
Chapter 225
Chapter 224
Chapter 223
Chapter 222
Chapter 221
Chapter 220
Chapter 219
Chapter 218
Chapter 217
Chapter 216
Chapter 215
Chapter 214
Chapter 213
Chapter 212
Chapter 211
Chapter 210
Chapter 209
Chapter 208
Chapter 207
Chapter 206
Chapter 205
Chapter 204
Chapter 203
Chapter 202
Chapter 201
Chapter 200
Chapter 199
Chapter 198
Chapter 197
Chapter 196
Chapter 195
Chapter 194
Chapter 193
Chapter 192
Chapter 191
Chapter 190
Chapter 189
Chapter 188
Chapter 187
Chapter 186
Chapter 185
Chapter 184
Chapter 183
Chapter 182
Chapter 181
Chapter 180
Chapter 179
Chapter 178
Chapter 177
Chapter 176
Chapter 175
Chapter 174
Chapter 173
Chapter 172
Chapter 171
Chapter 170
Chapter 169
Chapter 168
Chapter 167
Chapter 166
Chapter 165
Chapter 164
Chapter 163
Chapter 162
Chapter 161
Chapter 160
Chapter 159
Chapter 158
Chapter 157
Chapter 156
Chapter 155
Chapter 154
Chapter 153
Chapter 152
Chapter 151
Chapter 150
Chapter 149
Chapter 148
Chapter 147
Chapter 146
Chapter 145
Chapter 144
Chapter 143
Chapter 142
Chapter 141
Chapter 140
Chapter 139
Chapter 138
Chapter 137
Chapter 136
Chapter 135
Chapter 134
Chapter 133
Chapter 132
Chapter 131
Chapter 130
Chapter 129
Chapter 128
Chapter 127
Chapter 126
Chapter 125
Chapter 124
Chapter 123
Chapter 122
Chapter 121
Chapter 120
Chapter 119
Chapter 118
Chapter 117
Chapter 116
Chapter 115
Chapter 114
Chapter 113
Chapter 112
Chapter 111
Chapter 110
Chapter 109
Chapter 108
Chapter 107
Chapter 106
Chapter 105
Chapter 104
Chapter 103
Chapter 102
Chapter 101
Chapter 100
Chapter 99
Chapter 98
Chapter 97
Chapter 96
Chapter 95
Chapter 94
Chapter 93
Chapter 92
Chapter 91
Chapter 90
Chapter 89
Chapter 88
Chapter 87
Chapter 86
Chapter 85
Chapter 84
Chapter 83
Chapter 82
Chapter 81
Chapter 80
Chapter 79
Chapter 78
Chapter 77
Chapter 76
Chapter 75
Chapter 74
Chapter 73
Chapter 72
Chapter 71
Chapter 70
Chapter 69
Chapter 68
Chapter 67
Chapter 66
Chapter 65
Chapter 64
Chapter 63
Chapter 62
Chapter 61
Chapter 60
Chapter 59
Chapter 58
Chapter 57
Chapter 56
Chapter 55
Chapter 54
Chapter 53
Chapter 52
Chapter 51
Chapter 50
Chapter 49
Chapter 48
Chapter 47
Chapter 46
Chapter 45
Chapter 44
Chapter 43
Chapter 42
Chapter 41
Chapter 40
Chapter 39
Chapter 38
Chapter 37
Chapter 36
Chapter 35
Chapter 34
Chapter 33
Chapter 32
Chapter 31
Chapter 30
Chapter 29
Chapter 28
Chapter 27
Chapter 26
Chapter 25
Chapter 24
Chapter 23
Chapter 22
Chapter 21
Chapter 20
Chapter 19
Chapter 18
Chapter 17
Chapter 16
Chapter 15
Chapter 14
Chapter 13
Chapter 12
Chapter 11
Chapter 10
Chapter 9
Chapter 8
Chapter 7
Chapter 6
Chapter 5
Chapter 4
Chapter 3
Chapter 2
Chapter 1
~
~
~
~
~
~
~
~
~
~
~
~
~
~
~
~
~
~
Setting
Font
Arial
Georgia
Comic Sans MS
Font size
14
Background
Report
Donate
Oh o, this user has not set a donation button.
English
Español
lingua italiana
Русский язык
Portugués
Deutsch
Success Warn New Timeout NO YES Summary More details Please rate this book Please write down your comment Reply Follow Followed This is the last chapter. Are you sure to delete? Account We've sent email to you successfully. You can check your email and reset password. You've reset your password successfully. We're going to the login page. Read Your cover's min size should be 160*160px Your cover's type should be .jpg/.jpeg/.png This book hasn't have any chapter yet. This is the first chapter This is the last chapter We're going to home page. * Book name can't be empty. * Book name has existed. At least one picture Book cover is required Please enter chapter name Create Successfully Modify successfully Fail to modify Fail Error Code Edit Delete Just Are you sure to delete? This volume still has chapters Create Chapter Fold Delete successfully Please enter the chapter name~ Then click 'choose pictures' button Are you sure to cancel publishing it? Picture can't be smaller than 300*300 Failed Name can't be empty Email's format is wrong Password can't be empty Must be 6 to 14 characters Please verify your password again